TWiki> IGEM2007 Web>ProGress (07 Sep 2007, MollyAllen)EditAttach
iGEM Progress Updates

Projects

puc18-EXSP Biobrick plasmid

pSB1A3 and pSB1AC3 from the igem2007 plates DN work. This because we did not have the DH3.1B cells to transform the plamids into. So we are making a puc18 biobrick plasmid by inserting a oligonucleotide insert with the ecor1-xba1-spe1-pst1 restriction sites. We are following the design and protocol from Pam Silver's page on openwetware : http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts

Oligos:
biobrickpuc18-A 5'aattggctgaattcgcggccgcttctagagtactagtagcggccgctgcagc 3' (52bp)
biobrickpuc18-B 5' agctgctgcagcggccgctactagtactctagaagcggccgcgaattcagcc 3' (52bp)

Constructs:
Digest puc18 with ecor1 and hindIII. Ligate biobrickpuc18 oligonucleotide insert (has sticky ends) to puc18 R1/H3.

* 9/1/07 puc18 R1/H3

Oligos:

Checking:

Clone checks: gp130 in PCR4-TOPO and p85 in pCMV-SPORT6

Digest for gp130
  • 2 ul NEB2
  • 2 ul BSA
  • 15 ul gp130 midi (30 ng/ul)
  • 0.5 ul water
  • 0.5 ul SpeI? (10 u/ul)

Digest for p85

  • 2 ul NEB3
  • 2 ul BSA
  • 15 ul p85 midi (60 ng/ul)
  • 0.5 ul water
  • 0.5 ul PstI? (20 u/ul)

  • Incubate at 37 deg C for 1 hour
  • After running out on gel, gp130 should yield pieces of the sizes: 1014, 1889, 4082. OR it may yield sizes: 142, 1014, 5829. This is because it could have gone into pCRV-SPORT6 in either orientation.
  • After running out on gel, p85 should yield pices of sizes: 480, 1795, 5689.
Edit | Attach | Print version | History: r5 < r4 < r3 < r2 < r1 | Backlinks | Raw View | Raw edit | More topic actions
Topic revision: r5 - 07 Sep 2007 - 19:54:19 - MollyAllen
 
This site is powered by the TWiki collaboration platformCopyright © by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback